30 Additionally, VWF gene polymorphisms have already been associated with hypertension in past
30 Additionally, VWF gene polymorphisms have been associated with hypertension in past studies,31,32 making it a logical candidate for genetic…
30 Additionally, VWF gene polymorphisms have been associated with hypertension in past studies,31,32 making it a logical candidate for genetic…
Ov-Smirnov test. Variance of parametric data was compared using the “Levine’s test for equality of variance.” Comparisons amongst the groups…
Se anti-3-NT monoclonal antibody, Upstate). Sections have been rinsed with PBS and incubated with secondary antibodies for two hrs at…
YUFA LIU3, YUMING LIU4, WEIYI FENG5, SEN LI1, GUOYOU CHEN1 and TAIMING WEI1,College of Pharmacy, Harbin Medical University-Daqing, Daqing, Heilongjiang…
Oleaceae, but onlyBy chromosomal area LSC IRb SSC IRa 34.94 43.01 30.17 43.01 32.01 28.54 34.87 28.44 33.04 28.44 34.95…
Sed for true time PCR evaluation. Primer sets for mouse MafA (numbering relative to ATG, forward 757 TTCAGCAAGGAGGAGGTCAT and reverse…
Onsistent with this, in Neuro-2a cells that endogenously express CB1 at low levels, the allosteric modulators displayed an equivalent delay…
T; AMP, contraction amplitude; APSS, albumin-physiological salt option; AU, adsorption units; cGMP, cyclic guanosine monophosphate; EDD, end-diastolic diameter; eNOS, endothelial…
Eservatives (Yamamura et al., 2000; Shan et al., 2007). Despite from the confirmed efficiency of these chemical preservative in prevention…
Et al., 2006; Kim et al., 2007; Mashiguchi et al., 2011). Higher-order yuc mutants have defects in floral patterning and…