YUFA LIU3, YUMING LIU4, WEIYI FENG5, SEN LI1, GUOYOU CHEN1 and
YUFA LIU3, YUMING LIU4, WEIYI FENG5, SEN LI1, GUOYOU CHEN1 and TAIMING WEI1,College of Pharmacy, Harbin Medical University-Daqing, Daqing, Heilongjiang…
Category: Uncategorized
Oleaceae, but onlyBy chromosomal area LSC IRb SSC IRa 34.94 43.01 30.17 43.01 32.01 28.54 34.87 28.44 33.04 28.44 34.95 28.54 17.92 20.76 15.82 22.24 17.01 22.24 14.34 20.76 86,078 26,050 18,328 26,By codon
Oleaceae, but onlyBy chromosomal area LSC IRb SSC IRa 34.94 43.01 30.17 43.01 32.01 28.54 34.87 28.44 33.04 28.44 34.95…
Sed for real time PCR analysis. Primer sets for mouse MafA
Sed for true time PCR evaluation. Primer sets for mouse MafA (numbering relative to ATG, forward 757 TTCAGCAAGGAGGAGGTCAT and reverse…
Onsistent with this, in Neuro-2a cells that endogenously express CB
Onsistent with this, in Neuro-2a cells that endogenously express CB1 at low levels, the allosteric modulators displayed an equivalent delay…
T; AMP, contraction amplitude; APSS, albumin-physiological salt resolution; AU, adsorption units
T; AMP, contraction amplitude; APSS, albumin-physiological salt option; AU, adsorption units; cGMP, cyclic guanosine monophosphate; EDD, end-diastolic diameter; eNOS, endothelial…
Eservatives (Yamamura et al., 2000; Shan et al., 2007). Regardless of on the established
Eservatives (Yamamura et al., 2000; Shan et al., 2007). Despite from the confirmed efficiency of these chemical preservative in prevention…
Et al., 2006; Kim et al., 2007; Mashiguchi et al., 2011). Higher-order yuc mutants
Et al., 2006; Kim et al., 2007; Mashiguchi et al., 2011). Higher-order yuc mutants have defects in floral patterning and…
Nidulans wetA activates spore-specific gene expression. Mol. Cell. Biol. 11: 552. Martinelli, S.
Nidulans wetA activates spore-specific gene expression. Mol. Cell. Biol. 11: 552. Martinelli, S. D., 1994 Aspergillus nidulans as an experimental…
1C, multicopy (M) of AN1652 and AN9141 resulted in the fluffy
1C, multicopy (M) of AN1652 and AN9141 resulted in the fluffy phenotypes inside the absence of sfgA, suggesting these putative…
Nce of green fluorescent protein (eGFP) all through the root (Figure 1A
Nce of green fluorescent protein (eGFP) all through the root (Figure 1A). Sturdy red fluorescence demonstrated that the figwort mosaic…