Ected host against TB [4]. However, MTC can survive this inflammatory process and multiply within macrophages, by interfering with phagosome development, leading, in most cases, to a latent infection that may subsequently be reactivated, causing TB disease [3], [5]. Apoptosis seems to play an important role in the CMI response and TB control [6], [7]. The apoptosis of infected cells may limit bacterial growth by causing lysis of the bacteria within the apoptotic host cell, leading to the presentation of MTC antigens to T cells [8,9]. It has also been suggested that the pathogen may use anti-apoptotic mechanisms to ensure its survival and growth within infected cells and to inhibit the Fruquintinib custom synthesis development of T-cell immunity [10]. TNF-a appears to play a crucial role in reinforcing the host response to the pathogen [11] and TNF-a-dependent apoptosis seems to be a key element of immunity to TB. Various studies have suggested that molecules from the TNF-a family are involved in the apoptosis of macrophages or other cells infected with intracellular bacteria, including MTC [12]. For example, some virulent laboratory strains can 
induce the shedding of the TNF-a receptor (sTNFR2), which continues to bind its ligand, acting as a soluble antagonist of TNF-a preventing the lysis of infected host cells [13]. TNF-a acts through its membrane receptors, TNFR1 and TNFR2, which aggregate with other membrane and cytosolic proteins to form the “death-receptor complex” [14]. Signaling by these receptors initiates a cascade of reactions activating the proteins of the “death-signaling complex” (DISC), thereby initiating apoptosis [15] and limiting the replication of the intracellular bacteria [16]. Caspase-8 or FLICE is an essential pro-apoptotic component of the DISC, as is its antagonist, the FLICE-inhibitory protein or FLIP, which has a similar structure to FLICE but no catalytic activity and inhibits apoptosis. Recent observations have suggested that the DISC and certain “deathreceptor domain” molecules are also involved in the activation and proliferation of T cells [17,18]. The outcome of an MTC infection therefore probably depends on the balance between the various immune processes. MTC may stimulate apoptotic death in a subset of T cells, by triggering the release of large amounts of TNF-a, while preserving their host cell by inhibiting the response to TNF-a and increasing the production of anti-apoptotic factors [19,20,21,22,23]. In this study, we 1662274 tested this hypothesis in cohorts of TB patients, their recent household contacts and community controls from Madagascar, by using reverse transcriptase quantitative PCR (RTqPCR) to assess the expression of the TNFR1 and TNFR2, FLICE and FLIPs genes and evaluating cell counts.Table 1. Sequences of the primers and probes used to quantify gene expression by real-time PCR.Gene HuPONucleotide sequence L: GCTTCCTGGAGGGTGTCC P: TGCCAGTGTCTGTCTGCAGATTGG R: GGACTCGTTTGTACCCGTTGProduct size (bp)R2 0.TNFRL: CGGTGGAAGTCCAAGCTCTA R: GGGACTGAAGCTTGGGTTT P: CTGAAAAAGAGGGGGAGCTTGAAGGA0.TNFRL: ACCGTGTGTGACTCCTGTGA R: TCCACCTGGTCAGAGCTACA P: ACTGGGTTCCCGAGTGCTTGAGCT0.FLIPL: GTTCAAGGAGCAGGGACAAG R: ATCAGGACAATGGGCATAGG P: TGGATTGCTGCTTGGAGAACATTCC0.FLICEL: AAGTGCCCAAACTTCACAGC R: GGGGCTTGATCTCAAAATGA P: ACTTGGATGCAGGGGCTTTGACCAC0.L: Left primer (59——–39). R: Right primer (59——–39). P: Probe (59 FAM——–TAMRA 39). doi:10.1371/Mirin web journal.pone.0061154.tMaterials and Methods Ethics statementThe participants were enroll.Ected host against TB [4]. However, MTC can survive this inflammatory process and multiply within macrophages, by interfering with phagosome development, leading, in most cases, to a latent infection that may subsequently be reactivated, causing TB disease [3], [5]. Apoptosis seems to play an important role in the CMI response and TB control [6], [7]. The apoptosis of infected cells may limit bacterial growth by causing lysis of the bacteria within the apoptotic host cell, leading to the presentation of MTC antigens to T cells [8,9]. It has also been suggested that the pathogen may use anti-apoptotic mechanisms to ensure its survival and growth within infected cells and to inhibit the development of T-cell immunity [10]. TNF-a appears to play a crucial role in reinforcing the host response to the pathogen [11] and TNF-a-dependent apoptosis seems to be a key element of immunity to TB. Various studies have suggested that molecules from the TNF-a family are involved in the apoptosis of macrophages or other cells infected with intracellular bacteria, including MTC [12]. For example, some virulent laboratory strains can induce the shedding of the TNF-a receptor (sTNFR2), which continues to bind its ligand, acting as a soluble antagonist of TNF-a preventing the lysis of infected host cells [13]. TNF-a acts through its membrane receptors, TNFR1 and TNFR2, which aggregate with other membrane and cytosolic proteins to form the “death-receptor complex” [14]. Signaling by these receptors initiates a cascade of reactions activating the proteins of the “death-signaling complex” (DISC), thereby initiating apoptosis [15] and limiting the replication of the intracellular bacteria [16]. Caspase-8 or FLICE is an essential pro-apoptotic component of the DISC, as is its antagonist, the FLICE-inhibitory protein or FLIP, which has a similar structure to FLICE but no catalytic activity and inhibits apoptosis. Recent observations have suggested that the DISC and certain “deathreceptor domain” molecules are also involved in the activation and proliferation of T cells [17,18]. The outcome of an MTC infection therefore probably depends on the balance between the various immune processes. MTC may stimulate apoptotic death in a subset of T cells, by triggering the release of large amounts of TNF-a, while preserving their host cell by inhibiting the response to TNF-a and increasing the production of anti-apoptotic factors [19,20,21,22,23]. In this study, we 1662274 tested this hypothesis in cohorts of TB patients, their recent household contacts and community controls from Madagascar, by using reverse transcriptase quantitative PCR (RTqPCR) to assess the expression of the TNFR1 and TNFR2, FLICE and FLIPs genes and evaluating cell counts.Table 1. Sequences of the primers and probes used to quantify gene expression by real-time PCR.Gene HuPONucleotide sequence L: GCTTCCTGGAGGGTGTCC P: TGCCAGTGTCTGTCTGCAGATTGG R: GGACTCGTTTGTACCCGTTGProduct size (bp)R2 0.TNFRL: CGGTGGAAGTCCAAGCTCTA R: GGGACTGAAGCTTGGGTTT P: CTGAAAAAGAGGGGGAGCTTGAAGGA0.TNFRL: ACCGTGTGTGACTCCTGTGA R: TCCACCTGGTCAGAGCTACA P: ACTGGGTTCCCGAGTGCTTGAGCT0.FLIPL: GTTCAAGGAGCAGGGACAAG R: ATCAGGACAATGGGCATAGG P: TGGATTGCTGCTTGGAGAACATTCC0.FLICEL: AAGTGCCCAAACTTCACAGC R: GGGGCTTGATCTCAAAATGA P: ACTTGGATGCAGGGGCTTTGACCAC0.L: Left primer (59——–39). R: Right primer (59——–39). P: Probe (59 FAM——–TAMRA 39). doi:10.1371/journal.pone.0061154.tMaterials and Methods Ethics statementThe participants were enroll.