Overall tumour cells needle dissection of serial tumour sections was done to enrich for epithelial fractions prior to DNA extraction. In the Australian cohort, DNA was extracted using DNeasy kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. Affymetrix 50 k XbaI single nucleotide polymorphism (SNP) (Affymetrix, Santa Clara, CA, USA) mapping arrays were applied to obtain copy number profiles (for details see Materials and Methods S1 and [33]). Data are stored in the GEO database with the accession number GSE13813.Figure 3. Comparison of estimated log copy numbers in the two cohorts. A total of 2923 genomic loci spaced 1Mb from each other were defined, and the average estimated log copy number was found at each loci and in each of the two study cohorts. The resulting set of 2923 pairs of averages is shown in the figure, suggesting considerable consistency between the two study cohorts. doi:10.1371/journal.pone.0054356.gPatient population and clinicopathological dataThe Norwegian cohort, diagnosed and treated at the Department of Gynecological Oncology at the Oslo University Hospital The Norwegian Radiumhospital during the period May 1992 to February 2003, consisted of 74 patients diagnosed with SOC on routine pathology reports. All patients underwent primary surgery, followed by adjuvant platinum-based chemotherapy. A summary of the clinicopathological characteristics is shown in Table 1 and detailed information is provided in Table S1 (see also [32]). Progression-free survival (PFS) was defined as the time interval that elapsed between diagnosis and progression, based on the first confirmed sign of Methionine enkephalin price disease recurrence according to Gynecologic Cancer InterGroup (GCIG) definitions. Overall survival was defined as the time interval that elapsed between diagnosis and death of any cause [32]. Sensitivity to platinum-based chemotherapy was defined as no relapse within six months after the completion of the treatment. The second cohort, originally analysed in Australia [33], consisted of 70 patients diagnosed with SOC from 1988 to 2005, including 56 cases from Australia (from the Australian Ovarian Cancer Study (AOCS) and the Gynaecological Oncology Biobank at Westmead) and 14 cases from Japan. All patients received first-line platinum-based chemotherapy. A summary of the clinicopathological characteristics is shown in Table 1 and additional information is provided in Table S2 (further genetic information can be provided from AOCS Group on request). For this cohort, PFS was defined as the time interval between the date of diagnosis and the first confirmed sign of disease progression based on GCIG definitions. Overall survival was defined as the time interval between the date of histological diagnosis and the date of death from any cause [34]. Chemotherapy response was stratified based on progression-free interval; less than six months to disease progression was chosen as an end point to define resistantSegmentation and estimation of copy number dataTo segment the copy number data the Piecewise Constant Fitting (PCF) algorithm [35?7] was applied to log2-transformed copy number 94361-06-5 values for each sample. For a given number of breakpoints, PCF identifies the least-squares optimal segmentation of the data. The number of breakpoints, and thus the bias-variance trade-off, is controlled by a penalty parameter cw0 (c 12 in this study). The least number of probes in a segment was set to 3. For each segment a corresponding (log2-transfor.Overall tumour cells needle dissection of serial tumour sections was done to enrich for epithelial fractions prior to DNA extraction. In the Australian cohort, DNA was extracted using DNeasy kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. Affymetrix 50 k XbaI single nucleotide polymorphism (SNP) (Affymetrix, Santa Clara, CA, USA) mapping arrays were applied to obtain copy number profiles (for details see Materials and Methods S1 and [33]). Data are stored in the GEO database with the accession number GSE13813.Figure 3. Comparison of estimated log copy numbers in the two cohorts. A total of 2923 genomic loci spaced 1Mb from each other were defined, and the average estimated log copy number was found at each loci and in each of the two study cohorts. The resulting set of 2923 pairs of averages is shown in the figure, suggesting considerable consistency between the two study cohorts. doi:10.1371/journal.pone.0054356.gPatient population and clinicopathological dataThe Norwegian cohort, diagnosed and treated at the Department of Gynecological Oncology at the Oslo University Hospital The Norwegian Radiumhospital during the period May 1992 to February 2003, consisted of 74 patients diagnosed with SOC on routine pathology reports. All patients underwent primary surgery, followed by adjuvant platinum-based chemotherapy. A summary of the clinicopathological characteristics is shown in Table 1 and detailed information is provided in Table S1 (see also [32]). Progression-free survival (PFS) was defined as the time interval that elapsed between diagnosis and progression, based on the first confirmed sign of disease recurrence according to Gynecologic Cancer InterGroup (GCIG) definitions. Overall survival was defined as the time interval that elapsed between diagnosis and death of any cause [32]. Sensitivity to platinum-based chemotherapy was defined as no relapse within six months after the completion of the treatment. The second cohort, originally analysed in Australia [33], consisted of 70 patients diagnosed with SOC from 1988 to 2005, including 56 cases from Australia (from the Australian Ovarian Cancer Study (AOCS) and the Gynaecological Oncology Biobank at Westmead) and 14 cases from Japan. All patients received first-line platinum-based chemotherapy. A summary of the clinicopathological characteristics is shown in Table 1 and additional information is provided in Table S2 (further genetic information can be provided from AOCS Group on request). For this cohort, PFS was defined as the time interval between the date of diagnosis and the first confirmed sign of disease progression based on GCIG definitions. Overall survival was defined as the time interval between the date of histological diagnosis and the date of death from any cause [34]. Chemotherapy response was stratified based on progression-free interval; less than six months to disease progression was chosen as an end point to define resistantSegmentation and estimation of copy number dataTo segment the copy number data the Piecewise Constant Fitting (PCF) algorithm [35?7] was applied to log2-transformed copy number values for each sample. For a given number of breakpoints, PCF identifies the least-squares optimal segmentation of the data. The number of breakpoints, and thus the bias-variance trade-off, is controlled by a penalty parameter cw0 (c 12 in this study). The least number of probes in a segment was set to 3. For each segment a corresponding (log2-transfor.
Related Posts
Sed for real time PCR analysis. Primer sets for mouse MafA
Sed for true time PCR evaluation. Primer sets for mouse MafA (numbering relative to ATG, forward 757 TTCAGCAAGGAGGAGGTCAT and reverse 973CCGCCAACTTCTCGTATTTC; 217 bp) and mouse -actin (forward 778GCTCTTTTCCAGCCTTCCTT and reverse 945 CTTCTGCATCCTGTCAGCAA; 168 bp) had been utilized to quantify every single aspect. Electrophoretic Mobility Shift Assay–The gel-shift assay was performed with DIG Gel shift kit, […]
As recently been developed and consists of cell cycle markers, likeAs recently been developed and
As recently been developed and consists of cell cycle markers, likeAs recently been developed and consists of cell cycle markers, like urinary tissue inhibitor of metalloproteinases-2 (TIMP-2) and insulin like growth factor-binding protein 7 (IGFBP-7). Probably the most promising application of these biomarkers in oncology is their potential for early detection of nephrotoxicity by antineoplastic […]
Accomplishment would be the identical in males and females (e.g., no reproductive skew exists); but
Accomplishment would be the identical in males and females (e.g., no reproductive skew exists); but typically, males possess a higher variance in reproductive success than females, and therefore a decrease effective population size. This reproductive skew will thus affect ratios from the powerful population sizes of X-linked (or Zlinked) and autosomal genes, bringing the ratio […]