S of central importance in biology and biotechnology. When the interactions

S of central importance in biology and biotechnology. When the interactions are strong, proteins associate into a stable homo- or hetero-oligomer complex that can be isolated relatively easily. In many cases, however, interactions are transient or weak, producing a complex that is difficult to isolate. To study such complex, component proteins of the complex are chemically crosslinked or genetically fused as a single polypeptide to prevent the complex from dissociation. However, these methods have some limitations. Chemical cross-linking has a limited reactivity and is not easy to control the number of cross-linked proteins. Fused protein has structural restriction and is often difficult to express in a soluble form. For effective formation of complex, proteins should be linked with high flexibility enough to allow proteins to move and turn Ilomastat custom synthesis freely to associate with each other. Here we report a procedure to align several different proteins, all connected to a single flexible DNA backbone. This increases local concentrations of the proteins and will enable association of proteins with very weak interactions.the PrimeSTAR mutagenesis basal kit (Takara, Japan). We used Cerulean [1] and Venus [2] as improved CFP and YFP. A cysteine residue was introduced at the N-terminus of CFP (Cys-CFP) and at the 173 position of YFP (Cys-YFP), taking into consideration their orientations in the dimer [3]. A206K mutations (monomer propensity) and S208F/V224L mutations (dimer propensity) were also introduced. Proteins were expressed in Escherichia coli BL21(DE3) at 20uC for 20 hr. Harvested cells were sonicated in buffer (20 mM Tris-HCl, pH 7.4, 1 mM DTT, a Complete protease inhibitor mixture tablet (Roche Applied Science)) and centrifuged. In the case of sfGFP purification, cell lysate was heattreated at 80uC for 15 min 18325633 before centrifugation. The supernatant was applied to anion exchange column (DEAE-650M TOYOPEARL), eluted by step-wise increase of NaCl concentration (0?100 mM), and subsequently purified by Ni-sepharose column (GE healthcare).Azido-ODN (N3-ODN) Preparation59-NH2-(CH2)6-ODNs were synthesized by an automated DNA synthesizer using standard phosphoramidite chemistry. The lyophilized DNA was GGTI298 supplier dissolved in the buffer (100 mM BicineKOH, pH8.0, 1 mM EDTA) at the concentration of 100 mM. Azide-PEG4-NHS ester (160 mM) (Click Chemistry Tools, USA) in DMSO was added (final concentration, 5 mM) to the DNA solution and reacted for 2 hr at 37uC. The solution was applied to an anion exchange column (DEAE-650M TOYOPEARL) equilibrated with buffer (50 mM Tris-HCl, pH7.4, 50 mM NaCl). TheMaterials and Methods Protein PreparationExpression plasmid pET21c-His6-sfGFP-Cys was generated from pET21c-wild-type GFP by site-directed mutagenesis usingFlexible Alignment of ProteinTable 1. Sequence of ODNs 1527786 used in this study. Primary amine (NH2) was attached to 59-end via (CH2)6 spacer. Underlines indicate restriction enzyme sites.No.-(length) 1-(55 nt) 2-(55 nt) 3-(26 nt) 4-(55 nt) 5-(55 nt) 6-(26 nt)Sequence 59NH2-(CH2)6-CGATTGTGGTAGTGAATTCGTCCAGGTTTCTCTTAGAGGATCCAGTGAGCGTATC39 59NH2-(CH2)6-GATTACGATATTGCCCGGGTGTGTCATTTCGCTAGATCTCGAGGAGTCCGCAAAG39 59NH2-(CH2)6-GTTGTGAGTGAAGCTTAGCCATGATG39 59NH2-(CH2)6-CATCATGGCTAAGCTTCACTCACAACTTTCTTTGCGGACTCCTCGAGATCTAGCG39 59NH2-(CH2)6-TGACACACCCGGGCAATATCGTAATCTTTGATACGCTCACTGGATCCTCTAAGAG39 59NH2-(CH2)6-CCTGGACGAATTCACTACCACAATCGdoi:10.1371/journal.pone.0052534.tcolumn was washed three times with six-column volume of buffer (50 mM T.S of central importance in biology and biotechnology. When the interactions are strong, proteins associate into a stable homo- or hetero-oligomer complex that can be isolated relatively easily. In many cases, however, interactions are transient or weak, producing a complex that is difficult to isolate. To study such complex, component proteins of the complex are chemically crosslinked or genetically fused as a single polypeptide to prevent the complex from dissociation. However, these methods have some limitations. Chemical cross-linking has a limited reactivity and is not easy to control the number of cross-linked proteins. Fused protein has structural restriction and is often difficult to express in a soluble form. For effective formation of complex, proteins should be linked with high flexibility enough to allow proteins to move and turn freely to associate with each other. Here we report a procedure to align several different proteins, all connected to a single flexible DNA backbone. This increases local concentrations of the proteins and will enable association of proteins with very weak interactions.the PrimeSTAR mutagenesis basal kit (Takara, Japan). We used Cerulean [1] and Venus [2] as improved CFP and YFP. A cysteine residue was introduced at the N-terminus of CFP (Cys-CFP) and at the 173 position of YFP (Cys-YFP), taking into consideration their orientations in the dimer [3]. A206K mutations (monomer propensity) and S208F/V224L mutations (dimer propensity) were also introduced. Proteins were expressed in Escherichia coli BL21(DE3) at 20uC for 20 hr. Harvested cells were sonicated in buffer (20 mM Tris-HCl, pH 7.4, 1 mM DTT, a Complete protease inhibitor mixture tablet (Roche Applied Science)) and centrifuged. In the case of sfGFP purification, cell lysate was heattreated at 80uC for 15 min 18325633 before centrifugation. The supernatant was applied to anion exchange column (DEAE-650M TOYOPEARL), eluted by step-wise increase of NaCl concentration (0?100 mM), and subsequently purified by Ni-sepharose column (GE healthcare).Azido-ODN (N3-ODN) Preparation59-NH2-(CH2)6-ODNs were synthesized by an automated DNA synthesizer using standard phosphoramidite chemistry. The lyophilized DNA was dissolved in the buffer (100 mM BicineKOH, pH8.0, 1 mM EDTA) at the concentration of 100 mM. Azide-PEG4-NHS ester (160 mM) (Click Chemistry Tools, USA) in DMSO was added (final concentration, 5 mM) to the DNA solution and reacted for 2 hr at 37uC. The solution was applied to an anion exchange column (DEAE-650M TOYOPEARL) equilibrated with buffer (50 mM Tris-HCl, pH7.4, 50 mM NaCl). TheMaterials and Methods Protein PreparationExpression plasmid pET21c-His6-sfGFP-Cys was generated from pET21c-wild-type GFP by site-directed mutagenesis usingFlexible Alignment of ProteinTable 1. Sequence of ODNs 1527786 used in this study. Primary amine (NH2) was attached to 59-end via (CH2)6 spacer. Underlines indicate restriction enzyme sites.No.-(length) 1-(55 nt) 2-(55 nt) 3-(26 nt) 4-(55 nt) 5-(55 nt) 6-(26 nt)Sequence 59NH2-(CH2)6-CGATTGTGGTAGTGAATTCGTCCAGGTTTCTCTTAGAGGATCCAGTGAGCGTATC39 59NH2-(CH2)6-GATTACGATATTGCCCGGGTGTGTCATTTCGCTAGATCTCGAGGAGTCCGCAAAG39 59NH2-(CH2)6-GTTGTGAGTGAAGCTTAGCCATGATG39 59NH2-(CH2)6-CATCATGGCTAAGCTTCACTCACAACTTTCTTTGCGGACTCCTCGAGATCTAGCG39 59NH2-(CH2)6-TGACACACCCGGGCAATATCGTAATCTTTGATACGCTCACTGGATCCTCTAAGAG39 59NH2-(CH2)6-CCTGGACGAATTCACTACCACAATCGdoi:10.1371/journal.pone.0052534.tcolumn was washed three times with six-column volume of buffer (50 mM T.