. Mischel. Total RNA was isolated from both cell lines using Trizol according to manufacturer’s protocol. For all samples RNA concentration and purity was determined using a Nano-Drop 2000C spectrophotometer. A260/A280 nm was.1.9 for most samples. For each sample, 1 mg of RNA was used as template in the reverse transcription reaction using qScriptTM cDNA SuperMix in a 20 ml volume according to manufacturer’s protocol. February 2012 | Volume 7 | Issue 2 | e31723 EGFRvIII Expression in Oral Cancer n = 54 Sex Male Female Age Smoking 
History Never Past Current Alcohol History Never Moderate Heavy Former Heavy Not Stated Pathologic T Stage pT1 pT2 pT3 pT4 Pathologic N Stage pN0 pN1 pN2 Differentiation Well Moderate Poor Not Stated doi:10.1371/journal.pone.0031723.t001 10 31 6 7 28 7 19 8 19 12 15 6 19 15 10 4 12 12 30 38 16 61 Real-time PCR: Real-time PCR was performed on the ABI 7500 Real Time system using TaqManH probe-based chemistry. An EGFRvIII-specific gene expression assay was designed using the File Builder 3.1 software. The following primer/probe set was used: forward primer 59 TCTGCCCGGCGAGTC 39, reverse primer 59 GCCGTGATCTGTCACCACATAATT 39, FAM-labelled probe 59 TTTCTTTTCCTCCAGAGCCC 39. Briefly, 2 ml of cDNA product was used as template in a 50 ml PCR reaction containing 25 ml TaqManH Universal PCR Master Mix, 2.5 ml EGFRvIII primer/probe mix and 20.5 ml nuclease-free water. The following amplification protocol was performed: 50uC for 2 minutes, 95uC for 10 minutes; followed by 40 cycles of 95uC for 15 seconds each and finally 60uC for 1 minute. Fluorescent signals were collected during the 60uC/ 1 minute step. Baseline and threshold cycle number were determined manually. EGFRvIII PCR efficiency and linear dynamic range was assessed by using the following dilution series: 100 ng, 10 ng, 1 ng, 0.1 ng and 0.01 ng of U87MGvIII cDNA in triplicate. Both Beta-2-microglobulin and GAPDH served as reference genes. The glioblastoma cell line U87MGvIII over-expresses EGFRvIII and was used as a positive control; the parental cell line, U87MG expresses only wild-type EGFR and served as a negative control. Water was used as a no template control for the PCR reaction. EGFRvIII positive samples were retested to confirm the presence of EGFRvIII and the mean Ct number was used for data analysis. Relative expression of EGFRvIII was determined by delta Ct method which was calculated by subtracting the average Ct reference value from that of EGFRvIII. Conventional RT-PCR and Sequencing: ” cDNA was sequenced to verify EGFRvIII mutational status and validate the novel EGFRvIII rt RT-PCT assay. A PCI-32765 Nested PCR strategy was employed to maximize yield from FFPE tumor samples. Briefly, February 2012 | Volume 7 | Issue 2 | e31723 EGFRvIII Expression in Oral Cancer 2 ml of cDNA were amplified in the first round PCR in a total volume of 50 ml containing 16High Fidelity PCR Buffer, 0.2 mM dNTPs, 2 mM MgSO4, 20 pmol of each primer and 1 unit of Platinum Taq High Fidelity polymerase. Primers are located in exon 1 and exon 10 as described previously. PCR cycling conditions were: 94uC for 2 minutes followed by 43 cycles of 94uC/30 s, 55uC/30 s, 72uC/1 min and a final extension step of 72uC for 10 minutes. 1 ml of first round PCR reaction was used as template in a second round amplification using previously reported primers and conditions “ 25331948 with the exception that amplification was carried out for 30 cycles instead of 42. Nested PCR products were purified and resuspended